Sequence retrieval

Genome: Listeria monocytogenes SLCC2378
Start position: 168950
End position: 168994
Length: 45

DNA sequence
>NC_018585, from 168950 to 168994 (45 bp); Listeria monocytogenes SLCC2378 AGTACCGCCAACACCAGTACCACCAACACCAATACCGCCTACTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 167143-169212	Sequence	LMOSLCC2378_0175 - cell wall surface anchor family protein