Sequence retrieval

Genome: Listeria monocytogenes SLCC2378
Start position: 725315
End position: 725354
Length: 40

DNA sequence
>NC_018585, from 725315 to 725354 (40 bp); Listeria monocytogenes SLCC2378 TTTTTTCTTTTTTTGTATTTTTTTGTGTTTTTCTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 724852-725772	Sequence	LMOSLCC2378_0706 mogR motility gene repressor (Protein is coded in complementary strand; from 725772 to 724852)