Sequence retrieval

Genome: Listeria monocytogenes SLCC2378
Start position: 675955
End position: 675990
Length: 36

DNA sequence
>NC_018585, from 675955 to 675990 (36 bp); Listeria monocytogenes SLCC2378 GACACCAAAAGATACACCAAAAAATACACCAAAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 671367-676127	Sequence	LMOSLCC2378_0652 - cell wall surface anchor family protein