Sequence retrieval

Genome: Listeria monocytogenes SLCC2378
Start position: 358522
End position: 358557
Length: 36

DNA sequence
>NC_018585, from 358522 to 358557 (36 bp); Listeria monocytogenes SLCC2378 GTTTTGTTGCTTGTTTTGTTGCTGTTTTTGTTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 358392-359648	Sequence	LMOSLCC2378_0337 vip cell wall surface anchor family protein (Protein is coded in complementary strand; from 359648 to 358392)