Sequence retrieval

Genome: Listeria monocytogenes SLCC2378
Start position: 1625220
End position: 1625255
Length: 36

DNA sequence
>NC_018585, from 1625220 to 1625255 (36 bp); Listeria monocytogenes SLCC2378 GCTGCTTCTTTTGCTGCTTCTTTCGCTGCTTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1625202-1625657	Sequence	LMOSLCC2378_1619 - hypothetical protein (Protein is coded in complementary strand; from 1625657 to 1625202)