Sequence retrieval

Genome: Listeria monocytogenes SLCC2378
Start position: 2719244
End position: 2719276
Length: 33

DNA sequence
>NC_018585, from 2719244 to 2719276 (33 bp); Listeria monocytogenes SLCC2378 TTTGCTTTTGATTTGTTTTTTATTTACTTTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2718480-2719877	Sequence	LMOSLCC2378_2665 dgt deoxyguanosinetriphosphate triphosphohydrolase (Protein is coded in complementary strand; from 2719877 to 2718480)