Sequence retrieval

Genome: Listeria monocytogenes SLCC2378
Start position: 2083435
End position: 2083467
Length: 33

DNA sequence
>NC_018585, from 2083435 to 2083467 (33 bp); Listeria monocytogenes SLCC2378 TTTGTTTAATGTTTCTTCAATGTTTGTAAAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2083115-2083642	Sequence	LMOSLCC2378_2036 divIVA cell division initiation protein (septum placement) (Protein is coded in complementary strand; from 2083642 to 2083115)