Sequence retrieval

Genome: Listeria monocytogenes SLCC2378
Start position: 2407617
End position: 2407646
Length: 30

DNA sequence
>NC_018585, from 2407617 to 2407646 (30 bp); Listeria monocytogenes SLCC2378 CTTTTTCATCCTTTTTCCCCCTTTTTTATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2406817-2407626	Sequence	LMOSLCC2378_2353 - polar amino acid ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 2407626 to 2406817)
ORF... 2407643-2408179	Sequence	LMOSLCC2378_2354 - GNAT family acetyltransferase (Protein is coded in complementary strand; from 2408179 to 2407643)