Sequence retrieval

Genome: Listeria monocytogenes SLCC2378
Start position: 702455
End position: 702481
Length: 27

DNA sequence
>NC_018585, from 702455 to 702481 (27 bp); Listeria monocytogenes SLCC2378 TTCAGGAGCCTCAGGAGCCTCAGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 702372-703358	Sequence	LMOSLCC2378_0679 - hypothetical protein (Protein is coded in complementary strand; from 703358 to 702372)