Sequence retrieval

Genome: Listeria monocytogenes SLCC2378
Start position: 1385424
End position: 1385448
Length: 25

DNA sequence
>NC_018585, from 1385424 to 1385448 (25 bp); Listeria monocytogenes SLCC2378 TTTTTTTTATTTTTCTTTCTTTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1385431-1386258	Sequence	LMOSLCC2378_1394 oxaA2 inner membrane protein OxaA (Protein is coded in complementary strand; from 1386258 to 1385431)