Sequence retrieval

Genome: Listeria monocytogenes SLCC2378
Start position: 1113988
End position: 1114012
Length: 25

DNA sequence
>NC_018585, from 1113988 to 1114012 (25 bp); Listeria monocytogenes SLCC2378 TTTTTTTATTTTTTATCTTTTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1113994-1114881	Sequence	LMOSLCC2378_1096 galU UTP-glucose-1-phosphate uridylyltransferase (Protein is coded in complementary strand; from 1114881 to 1113994)