Sequence retrieval

Genome: Listeria monocytogenes SLCC2378
Start position: 626505
End position: 626528
Length: 24

DNA sequence
>NC_018585, from 626505 to 626528 (24 bp); Listeria monocytogenes SLCC2378 TTTGTATTAGTATTGGTATTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 626085-627518	Sequence	LMOSLCC2378_0606 iap cell wall hydrolases A (Protein is coded in complementary strand; from 627518 to 626085)