Sequence retrieval

Genome: Listeria monocytogenes SLCC2378
Start position: 2745840
End position: 2745863
Length: 24

DNA sequence
>NC_018585, from 2745840 to 2745863 (24 bp); Listeria monocytogenes SLCC2378 CAACAACACCAATAACAAAAACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2745053-2746738	Sequence	LMOSLCC2378_2691 kdpA K+-transporting ATPase, A subunit (Protein is coded in complementary strand; from 2746738 to 2745053)