Sequence retrieval

Genome: Listeria monocytogenes SLCC2378
Start position: 2467477
End position: 2467500
Length: 24

DNA sequence
>NC_018585, from 2467477 to 2467500 (24 bp); Listeria monocytogenes SLCC2378 CTCTTTTACTATTTTACTTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2467486-2467761	Sequence	LMOSLCC2378_2407 - hypothetical protein (Protein is coded in complementary strand; from 2467761 to 2467486)