Sequence retrieval

Genome: Listeria monocytogenes SLCC2378
Start position: 2399927
End position: 2399950
Length: 24

DNA sequence
>NC_018585, from 2399927 to 2399950 (24 bp); Listeria monocytogenes SLCC2378 TTGCTTTTCCTTCTGCTTTTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2399077-2399988	Sequence	LMOSLCC2378_2344 - indigoidine synthase A family protein (Protein is coded in complementary strand; from 2399988 to 2399077)