Sequence retrieval

Genome: Listeria monocytogenes SLCC2378
Start position: 1127329
End position: 1127352
Length: 24

DNA sequence
>NC_018585, from 1127329 to 1127352 (24 bp); Listeria monocytogenes SLCC2378 TGCACATGTACATGTACATGCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1127293-1127418	Sequence	LMOSLCC2378_1109 - hypothetical protein (Protein is coded in complementary strand; from 1127418 to 1127293)