Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 3591170
End position: 3591232
Length: 63

DNA sequence
>NC_018500, from 3591170 to 3591232 (63 bp); Bacillus thuringiensis HD-771 TTTGTTGGTTCTTTCACTTCTTCTTTTGTTTCTTCCACTTCTTTTGTTGGTTCTTTCACTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3590552-3593581	Sequence	BTG_18405 - internalin protein (Protein is coded in complementary strand; from 3593581 to 3590552)