Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 3266187
End position: 3266249
Length: 63

DNA sequence
>NC_018500, from 3266187 to 3266249 (63 bp); Bacillus thuringiensis HD-771 GCTTTTCTGTTCCTTCACCCGGCTTTTCTGTTCCTTCACCTGGTTTTTCTGTTCCTTCACCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3265961-3269779	Sequence	BTG_16870 - collagen adhesion protein (Protein is coded in complementary strand; from 3269779 to 3265961)