Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 3131272
End position: 3131334
Length: 63

DNA sequence
>NC_018500, from 3131272 to 3131334 (63 bp); Bacillus thuringiensis HD-771 GAGTCATTGTTTTTTCTTTAAGAGTCGCTGGTTTTTCTTTAAGCGTCACTGATTTTTCTTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3131178-3131438	Sequence	BTG_16170 - hypothetical protein (Protein is coded in complementary strand; from 3131438 to 3131178)