Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 2361558
End position: 2361620
Length: 63

DNA sequence
>NC_018500, from 2361558 to 2361620 (63 bp); Bacillus thuringiensis HD-771 CCTGGTTTCTCACCTTCGCCTTCTGGTTTTCCGCCTTCGCCTTCTGGTTTTCCACCTTCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2361219-2362976	Sequence	BTG_12015 - hypothetical protein (Protein is coded in complementary strand; from 2362976 to 2361219)