Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 2796023
End position: 2796076
Length: 54

DNA sequence
>NC_018500, from 2796023 to 2796076 (54 bp); Bacillus thuringiensis HD-771 TGTTCTTCTGCTTTCTTCTGTTCTTCTACTTTCTTCTGTTCTTCCGCTTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2795846-2796670	Sequence	BTG_14345 - hypothetical protein (Protein is coded in complementary strand; from 2796670 to 2795846)