Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 1652775
End position: 1652828
Length: 54

DNA sequence
>NC_018500, from 1652775 to 1652828 (54 bp); Bacillus thuringiensis HD-771 TTTTGTTTCTTTTCTTCTTCTTGTTTCTTTTGCTCTTCTAGTTTCTTTTGTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1652490-1654988	Sequence	BTG_08425 - penicillin-binding protein 1A (Protein is coded in complementary strand; from 1654988 to 1652490)