Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 1561839
End position: 1561892
Length: 54

DNA sequence
>NC_018500, from 1561839 to 1561892 (54 bp); Bacillus thuringiensis HD-771 TACTGGGCCTACCGGAAGTACTGGACCTACCGGAAGTACTGGGCCTACCGGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1561795-1561974	Sequence	BTG_07975 - hypothetical protein (Protein is coded in complementary strand; from 1561974 to 1561795)