Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 1561300
End position: 1561353
Length: 54

DNA sequence
>NC_018500, from 1561300 to 1561353 (54 bp); Bacillus thuringiensis HD-771 TCGGTCCCGTTATTCCGGTCGATCCCGTTATTCCGGTCGGTCCCGTTATTCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1560630-1561505	Sequence	BTG_07970 - collagen triple helix repeat protein (Protein is coded in complementary strand; from 1561505 to 1560630)