Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 5403916
End position: 5403963
Length: 48

DNA sequence
>NC_018500, from 5403916 to 5403963 (48 bp); Bacillus thuringiensis HD-771 GATATTGTTGCTGGTATTGCTGCTGATATTGCTGTTGATATTGCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5403450-5404181	Sequence	BTG_27700 - vrrA protein (Protein is coded in complementary strand; from 5404181 to 5403450)