Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 4852412
End position: 4852459
Length: 48

DNA sequence
>NC_018500, from 4852412 to 4852459 (48 bp); Bacillus thuringiensis HD-771 TGTTGAATGCCTTTTTCAATGCCTTTTTCAATGCCTTTTTCAATGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4852250-4852834	Sequence	BTG_24700 - hypothetical protein (Protein is coded in complementary strand; from 4852834 to 4852250)