Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 1982261
End position: 1982308
Length: 48

DNA sequence
>NC_018500, from 1982261 to 1982308 (48 bp); Bacillus thuringiensis HD-771 AACGTTATTTGTAACGTTATTGTTATTGTTATTTGTAACGTTATTTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1981854-1983146	Sequence	BTG_10170 - enterotoxin (Protein is coded in complementary strand; from 1983146 to 1981854)