Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 3141742
End position: 3141786
Length: 45

DNA sequence
>NC_018500, from 3141742 to 3141786 (45 bp); Bacillus thuringiensis HD-771 GTTCTTGTTTAGTGTTTTCCTGTTTAGTATTTTCTTGTTTAGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3141480-3142067	Sequence	BTG_16265 - lpxtg-motif cell wall anchor domain-containing protein (Protein is coded in complementary strand; from 3142067 to 3141480)