Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 4160787
End position: 4160822
Length: 36

DNA sequence
>NC_018500, from 4160787 to 4160822 (36 bp); Bacillus thuringiensis HD-771 CCAGCACCTACTGCAGCACCTACTGCAGCACCTACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4160757-4160978	Sequence	BTG_21050 - hypothetical protein (Protein is coded in complementary strand; from 4160978 to 4160757)