Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 3105242
End position: 3105277
Length: 36

DNA sequence
>NC_018500, from 3105242 to 3105277 (36 bp); Bacillus thuringiensis HD-771 TGTATATCTAAATGTATAACCAAATGTATAACCAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3104751-3105374	Sequence	BTG_16035 - hypothetical protein (Protein is coded in complementary strand; from 3105374 to 3104751)