Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 1407402
End position: 1407437
Length: 36

DNA sequence
>NC_018500, from 1407402 to 1407437 (36 bp); Bacillus thuringiensis HD-771 ATATTTGTAGTAATCTCTGTAGTAATATTTGTAGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1406925-1407992	Sequence	BTG_07280 - phage replication protein (Protein is coded in complementary strand; from 1407992 to 1406925)