Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 927309
End position: 927341
Length: 33

DNA sequence
>NC_018500, from 927309 to 927341 (33 bp); Bacillus thuringiensis HD-771 ATTTTTCAACACTTTTTCAACACTTTTTCAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 926872-927318	Sequence	BTG_04555 - hypothetical protein (Protein is coded in complementary strand; from 927318 to 926872)