Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 4193694
End position: 4193723
Length: 30

DNA sequence
>NC_018500, from 4193694 to 4193723 (30 bp); Bacillus thuringiensis HD-771 TTTTTTTGTTATTTTGTTTTTTTCTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4193703-4196819	Sequence	BTG_21200 - transporter AcrB/AcrD/AcrF family protein (Protein is coded in complementary strand; from 4196819 to 4193703)