Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 2594689
End position: 2594718
Length: 30

DNA sequence
>NC_018500, from 2594689 to 2594718 (30 bp); Bacillus thuringiensis HD-771 ACTATACTTTTCTGTACTTTCATATACTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2594120-2595430	Sequence	BTG_13220 - GTP-binding protein Der (Protein is coded in complementary strand; from 2595430 to 2594120)