Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 2481759
End position: 2481788
Length: 30

DNA sequence
>NC_018500, from 2481759 to 2481788 (30 bp); Bacillus thuringiensis HD-771 CTTTTATTTCCTTCCATTTCTATTTATTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2480929-2481759	Sequence	BTG_12660 - multidrug ABC transporter (Protein is coded in complementary strand; from 2481759 to 2480929)