Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 3442522
End position: 3442548
Length: 27

DNA sequence
>NC_018500, from 3442522 to 3442548 (27 bp); Bacillus thuringiensis HD-771 GGTTCAGCTGGTTTAGCTGGTTTAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3442141-3443433	Sequence	BTG_17730 - hypothetical protein (Protein is coded in complementary strand; from 3443433 to 3442141)