Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 2168255
End position: 2168281
Length: 27

DNA sequence
>NC_018500, from 2168255 to 2168281 (27 bp); Bacillus thuringiensis HD-771 CCTGTTGGACCTGTTGGACCTGTTGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2167349-2168326	Sequence	BTG_11145 - hypothetical protein (Protein is coded in complementary strand; from 2168326 to 2167349)