Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 2104393
End position: 2104419
Length: 27

DNA sequence
>NC_018500, from 2104393 to 2104419 (27 bp); Bacillus thuringiensis HD-771 TGAATACCCTGAATACCCTGAACACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2103655-2104725	Sequence	BTG_10885 - hypothetical protein (Protein is coded in complementary strand; from 2104725 to 2103655)