Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 179691
End position: 179717
Length: 27

DNA sequence
>NC_018500, from 179691 to 179717 (27 bp); Bacillus thuringiensis HD-771 TGGTCCAGTAGGTCCAGTAGGTCCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 178630-180204	Sequence	BTG_00845 - collagen triple helix repeat domain-containing protein (Protein is coded in complementary strand; from 180204 to 178630)