Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 1293981
End position: 1294007
Length: 27

DNA sequence
>NC_018500, from 1293981 to 1294007 (27 bp); Bacillus thuringiensis HD-771 TAGTACCAGTAGTATCAGTAGTACCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1293962-1294291	Sequence	BTG_06665 - hypothetical protein (Protein is coded in complementary strand; from 1294291 to 1293962)