Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 2604502
End position: 2604526
Length: 25

DNA sequence
>NC_018500, from 2604502 to 2604526 (25 bp); Bacillus thuringiensis HD-771 TTTTTTTATTTTTATTTTATTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2604519-2604728	Sequence	BTG_13285 - hypothetical protein (Protein is coded in complementary strand; from 2604728 to 2604519)