Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 2517496
End position: 2517520
Length: 25

DNA sequence
>NC_018500, from 2517496 to 2517520 (25 bp); Bacillus thuringiensis HD-771 AACTACACTAAACAATACTAAACTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2517008-2518222	Sequence	BTG_12790 - secreted polysaccharide polymerase (Protein is coded in complementary strand; from 2518222 to 2517008)