Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 4260653
End position: 4260676
Length: 24

DNA sequence
>NC_018500, from 4260653 to 4260676 (24 bp); Bacillus thuringiensis HD-771 AAAAAAAGAAAAAACGAAGAAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4258698-4260749	Sequence	BTG_21510 - penicillin-binding protein (Protein is coded in complementary strand; from 4260749 to 4258698)