Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 3973523
End position: 3973546
Length: 24

DNA sequence
>NC_018500, from 3973523 to 3973546 (24 bp); Bacillus thuringiensis HD-771 TTTTCCTGTTCCGTTTCCTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3973418-3974905	Sequence	BTG_20125 - hypothetical protein (Protein is coded in complementary strand; from 3974905 to 3973418)