Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 3598429
End position: 3598452
Length: 24

DNA sequence
>NC_018500, from 3598429 to 3598452 (24 bp); Bacillus thuringiensis HD-771 TCCTTTTCCTTTTTCTTTTGCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3597671-3599695	Sequence	BTG_18425 - sensory box/GGDEF family protein (Protein is coded in complementary strand; from 3599695 to 3597671)