Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 3237032
End position: 3237055
Length: 24

DNA sequence
>NC_018500, from 3237032 to 3237055 (24 bp); Bacillus thuringiensis HD-771 TTTCTTTTTGTTCTTCTTTTTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3236464-3237435	Sequence	BTG_16745 - oligopeptide ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 3237435 to 3236464)