Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 3207337
End position: 3207360
Length: 24

DNA sequence
>NC_018500, from 3207337 to 3207360 (24 bp); Bacillus thuringiensis HD-771 ATTTTTTCCTTTTTTCATATTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3207131-3208771	Sequence	BTG_16605 - hypothetical protein (Protein is coded in complementary strand; from 3208771 to 3207131)