Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 2455678
End position: 2455701
Length: 24

DNA sequence
>NC_018500, from 2455678 to 2455701 (24 bp); Bacillus thuringiensis HD-771 TTCTGGTTCAGGTTTTGGCTCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2455577-2457151	Sequence	BTG_12505 fliF flagellar MS-ring protein (Protein is coded in complementary strand; from 2457151 to 2455577)