Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 2296494
End position: 2296517
Length: 24

DNA sequence
>NC_018500, from 2296494 to 2296517 (24 bp); Bacillus thuringiensis HD-771 TAAAAATAATAATAAAAAGAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2296312-2296650	Sequence	BTG_11725 - sensor histidine kinase (Protein is coded in complementary strand; from 2296650 to 2296312)