Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 1632725
End position: 1632748
Length: 24

DNA sequence
>NC_018500, from 1632725 to 1632748 (24 bp); Bacillus thuringiensis HD-771 TAATCCTAGTCCTAATGCTAATCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1631787-1632989	Sequence	BTG_08325 - oxalate/formate antiporter (Protein is coded in complementary strand; from 1632989 to 1631787)